Document Type : Research papers
Authors
1 Department of Agricultural Botany, Faculty of Agriculture (Saba Basha) Alexandria University, Egypt.
2 Department of Floriculture, Horticulture Research Institute, Agriculture Research Center, Alexandria, Egypt.
3 Department of Genetics, Faculty of Agriculture (Ain Shams) University, Cairo, Egypt
4 Biotechnology School, Nile University, Giza, Egypt
5 Department of Floriculture, Horticulture Research Institute, Agriculture Research Center, Alexandria, Egypt
Abstract
Keywords
Main Subjects
INTRODUCTION
Egypt is rich in biodiversity because it contains significant differences in its ecosystem from dry, salty, drought, desert, water bodies, flat lands, and mountainous environments, which are differed in temperature and humidity, besides it has distinct geographic location between three continents of Africa, Europe, and Asia. The diversity of the Egyptian plants includes various life forms such as trees, shrubs, bushes herbs, water and parasitic plants. So, the discriminatory and identification of plant cover in Egypt are very important for conservation and improvement of such plant biodiversity. Usually, plant description dependents on morphological character such identification is not always reliable and effective (Ali et al., 2014). In these cases plant species can be identified by using DNA chloroplast barcode marker which is a beneficial tool for plant species description or identification and phylogenetic construction (Kang et al., 2017).
The barcode consortium of life in 2009 considered the two genes rbcL and matK can be considered as molecular markers which used to explain the diversity and determine affiliation the plant samples to their species, in which the morphological diagnostic characters are not accurate enough (O. Elansary et al., 2017). Besides has various applications and used for ecological surveys to unknown taxon (Dick & Kress, 2009).
The chloroplast genes (rbcL and matK) are widely used for standard barcodes and defined regions of the chloroplast DNA (maturasek or matK and ribulose- 1.5 biphosphates carboxylase oxygenase large subunit or rbcL). The selected rbcL and matK as a barcode region was dependent on the accurate recovery of the rbcL district and the matK has discriminatory power (Hollingsworth et al., 2011).
The Ficus genus has multiple different species of woody plants and shrubs, it consists of approximately 850 species spread in tropical and semitropical regions. Most species are diploid including the chromosome number (2n= 26) (Condit, 1964). Some species are used as fuel and animal feed. Other species: F. elastica produces crude rubber as a natural extraction from its stem in its original habit. Another species like F. benjamina, F. lyrata warb., and F. pumila are grown for their ornamental value both as landscape plants and foliage ornamental ones used for inside decorative (Fang et al., 2007). There are famous species worldwide for their fruits that contain important nutrients like F. sycomorous, it was a sacred tree for the ancient Egyptians and F. carica where spread along the northwest coast from Alexandria to Matrouh. Some species of Ficus are used as interior and outdoor ornamental plants. Some Ficus species are used as traditional medicine (Nawaz et al., 2019).
In Egypt, the Ficus trees are widespread for ornamentation the gardens and roads inside and outside cities and some species are used as plant fence for farms beside the two-fruit production species; F. carica and F. sycomorous. To develop a program for conserve this biological diversity of such species, we must survey the different species planted in different regions, by making a complete morphological description of them, and applying molecular genetic barcoding which gives the accurate differences and similarity among these biological variants in addition to give a phylogenetic tree to describe the evolutionary relation among them.
MATERIAL AND METHOD:
Plant material:
Leaves of 15 different trees of Ficus species were collected, in Zip lock plastic bags, from Antoniadis - garden – Alexandria - Egypt. The species name is, F. retusa, F. benjamina, F. afzelii, F. microcarpa, hawii, F. lyrata, F. elastica Roxb ex Hornem, F. benjamina var golden, F. sycomorus, F. elastica decora, F. religiosa, F. altissima, F. benghalensis, F. aspera, F.tinctoria and F. platyphlla.
Morphological description:
To clarify the specification of the plant species, Leaf morphology of the different species as structure, shape, color, surface texture and dimension was taken under consideration as recommended by those (Mostafa et al., 2020, IPGRI, C. (2003) and Fatihah et al., 2014) (see Table 2 and 3 ).
DNA barcoding analysis:
DNA extraction and PCR amplification of rbcl and matk genes:
Total genomic DNA was extracted from leaves from different plant species by using i- genomic plant DNA Extraction mini kit (lot No: 13110251) company of (intron biotechnology, Inc. South Korea).The PCR was performed for the extracted DNA of each studded species using the primers of the two candidate genes (Maloukh et al., 2017).as found in Table 1
Table (1): Sequence of primers used in the current study.
|
Locus |
Sequence |
Tm |
|
rbcL a |
(F) (5`ATGTCACCACAAACAGAGACTAAAGC3`) (R )(5`GTAAAATCAAGTCCACCRCG3`) |
57.2°C 52.8°C |
|
matK- KIM |
(F) (5`CGTACAGTACTTTTGTGTTTACGAG3`) (R)(5` ACCCAGTCCATCTGGAAATCTTGGTTC3`) |
53.9°C 60.4°C |
To determine the optimum annealing temperatures of the primers used, the reaction volume was 25µl containing 12.5 µl Taq Red Mix, 2x Master mix (bioline) (Master mix with dye), 1.25 µl (12.5 µmole) forward primer, 1.25 µl (12.5 µmole) reverse primer,3 µl DNA template and complete the reaction with 7 µl d HշO (distilled water). Reaction PCR condition were performed as follows: Initial DNA denaturation at 94°C for 5 minutes, followed by 35-40 cycles of final DNA denaturation at 94°C for 45 second, primer annealing temperature at 50°C for 45 second, DNA strand extension at 72°C for 1 minute, and final extension at 72°C for 7 minutes and 12 °C for ∞. The PCR products were verified by electrophoresis in 1.6 % agarose gel stained with ethidium bromide. The PCR products were sent to colors medical laboratories. Eltehad Square, Maadi –Cairo - Egypt for DNA sequencing and the sequences were obtained. All the obtained sequences were submitted to GenBank.
Sequencing and phylogenetic analysis
Results obtained based on comparative (rbcL and matK ) chloroplast genes analysis have allowed the elucidation of some disputable questions of systematics and phylogeny of the fifteen Ficus species studied and the resultant of interesting new data. PCR product of 600 - 900 bp size amplification was observed using rbcL and matK primers respectively (Fig. 1) in fifteen Ficus taxa. These sequences are visualized by Chromas 2.4.4. The gained forward and reverse sequences were assembling and aligned using BioEdite software version 7. 0.5,3 (Hall, 1999) the matK and rbcL sequences for all samples were checked by GenBank databases. The Phylogenetic tree analysis relationships among the different species samples, were conducted through Neighbor Joining (NJ) trees using MEGAX version 10.0.1 (Kumar et al., 2018).
RESULT:
Morphological study:
Fourteen morphological parameter of the fifteen Ficus species are presented in Tables (2 and 3) .The obtained results showed the smallest length and width of leaf were recorded for F. microcarpa Hawaii (4.72 and 0.92cm respectively) (Fig 2 and 3), while the tallest length observed in F. lyrata, F. afzelii and F. aspera (24.46 and 23.2 and 22.41 cm, respectively )(see Fig .4) and the largest width in two species were pointed to F. lyrata ,F. platyphylla (14.76 and 14.56cm, respectively). The leaf petioles length ranged from 0.52 cm for F.tinctoria to 11.8 cm for F. religiosa (Fig. 4).The leaf texture of the Ficus species was recorded as smooth in all species except for F. aspera parcelii and F. sycomorus, which was recorded as rough. F. aspera parcelii has serrated leaf margin trait while, the F. platyphylla, F. lyrata and F. bengamina have waved leaf edge, while the other species have entire leaf edge.
The shape of leaf in the most species were elipetic ovate except for both F. afzelii, F. religiosa and F.tinctoria which showed obovate, cordate and lencolate shape respectively. Simple type of leaves was arranged in alternate shape on stem in all species.
The base of leaf was differed from cordate, cuneate, trunceate and rounded in (F. lyrata, F. platyphlla,F. aspera and F. religiosa), (F. retusa , F. afzelii, F. microcarpa, F.tinctoria and F. altissima), .(F.benghalensis and F. sycomuros) and (F. elastica decora, F. elastica .Roxb ex .Horenm, F. benjamina golden and F. benjamina) respectively.
The apex acute of leaf was observed in F. retusa, F. microcarpa, F. altissima and F. afzelii, while the apex acuminates was observed in the most species except for F.platyphlla was cuspidate (Table 2).
To determine the leaf colour as an optical trait by eye as green, shiny green and variegated colour. According to this categorical classification species F. benjamina has shiny green colour. While the species F. microcarpa hawaii, F. benjamina var gold and F. aspera parcelii have variegated colour. The most of Ficus species have green colour. The venation of leaf was pinnate in F. retusa, F. benjamina, F. microcarpa hawaii, F.tinctoria, F. elastica, F. elastica Roxb ex Hornem and F. benjamina golden. However, the leaf venation were prominent noticed in the other Ficus species (Table 3). The milky latex observed in the most species except F.tinctoria (Table. 3).
Figure (1) : Leaf shapes of Ficus sp:(1- Ficus retusa, 2- Ficus benjamina, 3- Ficus afzelii, 4- Ficus microcarpa. hawii, 5- Ficus lyrata, 6- Ficus elastica Roxb, 7- Ficus benjamina var golden, 8- Ficus sycomorus, 9- Ficus elastica. 10- Ficus religiosa, 11- Ficus alttisima, 12- Ficus benghalensis. 13- Ficus aspera, 14- Ficus tinctoria, 15- Ficus platyphlla).
Table (2): Quantitative and qualitative morphological data were measure from mature plants). Using 10 randomly replication for studied the leaf, shape, length (cm), and width (cm),, apex. base , petiole length (cm), surface texture (determined as 0= rough and 1=smooth), margin, (recorded as Waved Entire and Serrated).
|
Species |
Length (cm) |
Width (cm) |
Petiole length (cm) |
Apex |
Base |
Shape |
Surfac texture |
Arrangement |
Margin |
|
F. retusa |
9 |
3.228 |
1.32 |
Acute |
Cuneate |
Eliptic |
smooth |
1 |
Entire |
|
F. Benjamina |
7.6
|
3.46 |
1.08 |
Acuminate |
Rounded |
Eliptic (oval) |
smooth |
1 |
Slightly wave |
|
F.afzelii |
23.2
|
6.8 |
3.24 |
acute |
Cuneate |
obovate |
smooth |
1 |
Entire |
|
F. microcarpa-hawii |
4.72 |
2.22 |
0.92 |
Acute |
Cuneate |
Eliptic |
smooth |
1 |
Entire |
|
F.lyrara |
24.46 |
14.76 |
1.74 |
truncate |
Cordate |
Fiddle leaf |
smooth |
1 |
wave |
|
F. elastica Roxb.ex Hornem |
12.65
|
6.32 |
3.94 |
Shortly Acuminate |
Rounded |
Eliptic (oval) |
smooth |
1 |
Entire |
|
F. benjamina gold |
7.64
|
4.8 |
1.26 |
Acuminate |
Rounded |
Eliptic (oval) |
smooth |
1 |
Entire |
|
F. sycumorus |
8.75
|
5.16 |
2.72 |
subacute |
Truncate |
Eliptic |
Rough |
1 |
Entire |
|
F. elastic |
21.62
|
12.08 |
4.42 |
Acuminate |
Rounded |
Eliptic (oval) |
smooth |
1 |
Entire |
|
F. religiosa |
17.496
|
10.44 |
11. 8 |
Long Acuminate |
Cordate |
cordate |
smooth |
1 |
Entire |
|
F. altissima |
16.8
|
7.9 |
4.38 |
Acute |
Cuneate |
ovate |
smooth |
1 |
Entire |
|
F. benghalensis |
10.84
|
6.6 |
2.6 |
Rounded |
Trunceat |
ovate |
smooth |
1 |
Entire |
|
F. aspera |
22.41
|
12.46 |
0.88 |
accuminate |
Cordate |
oval |
rough |
1 |
Serrated |
|
F. tinctoria |
8.66 |
3.14 |
0.52 |
accuminate |
Cuneat |
lanceolate |
smooth |
1 |
Entire |
|
F. platyphlla |
16.26
|
14.56 |
10.3 |
cuspidate |
Cordate |
elliptic |
smooth |
1 |
wave |
Table (3): Leaf color (obtained as variegated and Green), type leaves (record as compound and simple), , arrangement venation (record as 0= pinnate and 1= prominent), latex (record as 0=absence , 1= present) , aerial roots ( record as 0=absence , 1= present).
|
Species |
Leaf color |
Leaf venation |
Aerial root |
Milky latex |
Leaf type |
|
F. retusa |
green |
0 |
1 |
1 |
simple |
|
F. Benjamina |
Shiny green |
0 |
0 |
1 |
simple |
|
F. afzelii |
green |
1 |
0 |
1 |
simple |
|
F. microcarpa-hawii |
Variegated |
0 |
1 |
1 |
simple |
|
F. lyrara |
green |
1 |
0 |
1 |
simple |
|
F. elasica Roxb.ex Hornem |
green |
0 |
0 |
1 |
simple |
|
F. benjamina gold |
variegated |
0 |
0 |
1 |
simple |
|
F. sycumorus |
green |
1 |
0 |
1 |
simple |
|
F. elastic |
green |
0 |
0 |
1 |
simple |
|
F. religiosa |
green |
1 |
0 |
1 |
simple |
|
F. altissima |
green |
1 |
0 |
1 |
simple |
|
F. benghalensis |
green |
1 |
1 |
1 |
simple |
|
F. aspera |
variegated |
1 |
0 |
1 |
simple |
|
F. tinctoria |
green |
1 |
0 |
0 |
simple |
|
F. platyphlla |
green |
1 |
1 |
1 |
simple |
Figure (2): Histogram of 15 species from Ficus genus determined length of leaf (cm)
Figure (3): Histogram of 15 species from Ficus genus determined width of leaf (cm)
Figure (4): Histogram of 15 species from Ficus genus determined length of petiole (cm)
RbcL gene: PCR amplification, and sequencing.
The amplification of rbcL yielded PCR products about 93% (14/15) of species. The query sequences identified on species level of 14 plants were 97 to 100% in either of the algorithms. The generated query sequences of 14 plants were matched with the reference sequences in BLAST /NCBI, (Table.4). The identification success was equally great for 12 species using the rbcL locus. Accession numbers are obtained for the respective plant species: F. retusa (MN102667.1), same accession number (KT718118.1) for F. benjamina and F. benjamina var gold was determines. All of F. lyrata (JQ773728.1), F. microcarpa (MN099002.1), F. elastica Roxb. ex Hornem and F. elastica decora were distinguished by accession number (MN098997.1). Accession number for F. religiosa, F. altissima, F. benghalensis, F. tinctoria and F. platyphlla were (KF381142.1), (GU135133.1), (MG946836.1), (JQ773784.1) and (KX783880.1) respectively. On the other hand two different morphological species were identified as the same species through sequence alignment with F. hirta (MN364796.1) this can be, explained on the basis that these two species are hybrids of both species.
MatK gene PCR amplification and sequencing:
The gene of matK amplified only 80% (12/15) of the tested plant taxa and rate 73.33 %(11/15) for sequences . When the matK sequences were aligned with the reference sequences in BLAST/ NCBI (Table.4), only 60 %(9/15) resulted in correct species identification. Accession numbers were (GU935043.1) for F. retusa, (JQ773506.1) for F. benjamina and F. benjamina var Gold, (AB925064.1) for F. microcarpa, (JX495717.1) for F. sycumorus, (JQ773471.1) for F. elastica decora, (KR530802.1) for F. altissima, (MG946963.1) for F. benghalensis and (JQ773602.1) for F.tinctoria. Two of the query sequences mis-matched, the F. elastica Roxb. ex Hornem with Ficus sp moore 315 (EU002177.1) and F. aspera with F. hirta chloroplast complete genome (MN364706.1). The matK algorithm is not able to identify the species due to the absence of species specific unique regions.
Phylogenetic tree Analysis for rbcL gene:
The relationships among 14 Ficus species estimated the sequences were alignment using Bioedit software and the construction for the phylogenetic tree using the NJ method by MEGA x software. The phylogenetic tree divided into two main clusters, the first cluster was further separated into two subgroups, the first subgroup contains (F. afzelii G.Don) as out group and the second subgroup contains (F. elastica decora, F. benjamina var gold prestigious, F. elastica Roxb ex Hornem and F. platyphlla). The most closely related species (F. benjamina var gold and F. elastica decora ) as sister group. The second cluster cont ained nine species (F.lyrata , F.benjamina, F.tinctoria, F. altissima, F. aspera, F. benghalensis, F. retusa, F. religiosa and F. microcarpa. hawii). The highest similarity was found between (F. aspera and F. benghalensis) and between (F. retusa and F. microcarpa hawii) (Fig. 6)
Phylogenetic tree Analysis for matK gene:
The relation among 11 Ficus species measured by the sequences were alignment using Bioedit software and the phylogenetic tree was constructed using the NJ method by MEGA x software this alignment. The phylogenetic tree was divided into two main clusters. The first cluster involved 10 species (F. elastica decora, F. benjamina var gold prestigious, F. elastica Roxb ex Hornem, F.benjamina, F.tinctoria, F. altissima, F. benghalensis, F. retusa, F.sycomorus and F. microcarpa. hawaii).The highest similarity was found between (F. benjamina var gold, F. microcarpa hawaii, F. elastica decora, F. benghalensis and F. altissima).The second cluster contained only one species F. aspera. (fig. 7).
Figure (5): Gel electrophoresis for 14 species of Ficus tree after purification of rbcL and matK
Table (4): Result of Matching with reference sequence on Blast Ncbi for rbcL and matK.
|
Names
|
Matching with reference sequence on Blast Ncbi for rbcL
|
rbcL Blast GenBank Accession No. |
Matching with reference sequence on Blast Ncbi for matK
|
matK Blast GenBank Accession No. |
|
F. retusa |
F. retusa |
MN102667.1 |
F. retusa |
GU935043.1 |
|
F. benjamina |
F. benjamina |
KT718118.1 |
F. benjamina |
JQ773506.1 |
|
F. afzelii |
F. hirta |
MN364706.1 |
……….. |
……….. |
|
F. microcarpa-hawii |
F. microcarpa |
MN099002.1 |
F. microcarpa |
AB925064.1 |
|
F. lyrara |
F. pandorata |
JQ773728.1 |
……….. |
……….. |
|
F. elastica Roxb.ex Hornem |
F.elastica |
MN098997.1 |
F. sp moore 315 |
EU002177.1 |
|
F. benjamina gold |
F.benjamina |
KT718118.1 |
F. benjamina |
JQ773506.1 |
|
F. sycumorus |
......... |
.......... |
F. sycumorus |
JX495717.1 |
|
F. elastica |
F. elastica |
MN098997.1 |
F.elastica |
JQ773471.1 |
|
F. religiosa |
F. religiosa |
KF381142.1 |
………… |
…………. |
|
F. altissima |
F. altissima |
GU135133.1 |
F. altissima |
KR530802.1 |
|
F. benghalensis |
F. benghalensis |
MG946836.1 |
F. benghalensis |
MG946963.1 |
|
F. aspera |
F. hirta |
MN364706.1 |
F.hirta |
MN364706.1 |
|
F. tinctoria |
F. tinctoria |
JQ773784.1 |
F.tinctoria |
JQ773602.1 |
Figure (6): Molecular Phylogenetic tree analysis using rbcL gene for14 Species by Neighbor-Joining method (Saitou and Nei, 1987).The optimal tree with the sum of branch length = 322.71875000 is shown. The evolutionary distances were computed using the number of differences method (Nei and Kumar, 2000). There were a total of 582 positions in the final dataset. Evolutionary analyses were conducted in MEGA X (Kumar et al., 2018).
Figure (7): Molecular Phylogenetic tree analysis using matK gene for11 Species by Neighbor-Joining method (Saitou and Nei, 1987).The optimal tree with the sum of branch length = 415.15625000 is shown. The evolutionary distances were computed using the number of differences method (Nei and Kumar, 2000) and are in the units of the number of base differences per sequence. There were a total of 751 positions in the final dataset. Evolutionary analyses were conducted in MEGA X (Kumar et al., 2018).
The evaluation of variation among species with three parameters:
With different parameters such as nucleotide frequencies, measure of Tajima D value, and the measured values of transition/transversion bias (R) indicated the existence of a wide divergence pattern of rbcL and matK in fourteen Ficus specie. We further computed the Maximum Composite Likelihood (MCL) measure of the pattern of nucleotide substitution according to (Tamura et al., 2004) and Compute nucleotide frequencies .
The rbcL sequence divergence among taxa:
The rbcL was used as a DNA barcode region for the identification of most plants at the species level. rbcL is used for phylogenetic studies due to the facility of amplification, alignment, and sequencing. The sequence was (600 bp) in each of the Ficus species and the averages of nucleotide frequencies were A (28.82%), T/U (29.50%), C (20.42%), and G (21.26%). Nucleotide frequency of rbcL were variable in the fourteen of the Ficus species (Table 5). The average of GC was (41.75%) and AT (58. 3%). This experiment analysis showed that transversions were more than transitions. Moreover. result of transition/transversion bias were (R= 0.956) in Table (7) and the evaluated nucleotide diversity value(π) using the Tajima Neutrality test, as shown in table (9). A total of 312 segregating sites (S) from a total 582 position demonstrating a nucleotide diversity rate of (0.254768) among species of Ficus genus were recorded. A positive value of the D test of Tajima was obtained for the rbcL region.
The matK sequence divergence among taxa:
The matK sequence length was (900 bp) in each Ficus species and the averages of nucleotide frequencies were A (36.8%), T/U (31.8%), C (15.7%), and G (15.7%). which were so far identical in the eleven species of Ficus (Table 6), the average GC was (31.4%) and AT was (68.63%).In the present investigation we found that transversions less than transitions. Moreover, matK indicated evolutionary rate for Ficus species, because the results of transition/transversion bias (R= 1.172) in Table (8) and the evaluated nucleotide diversity value (π), using the Tajima Neutrality test, as shown in Table (9). There were a total of 751 positions with a total of 411 segregating sites (S) demonstrating a lower nucleotide diversity rate (0.101416) among species of Ficus genus. A negative value of the test D of Tajima was obtained for the matK region.
Table (5):The evolutionary analyses of nucleotide frequencies among 14 species of Ficus genus for rbcL gene.
|
The names of species |
T(U) |
C |
A |
G |
Total
|
AT |
GC |
|
Ficus afzelii g . don |
28.0 |
22.5 |
30.4 |
19.1 |
582 |
58.4 |
41.6 |
|
Ficus altissima |
30.4 |
19.4 |
28.0 |
22.3 |
583 |
58.4 |
41.7 |
|
Ficus aspera |
30.2 |
19.6 |
28.0 |
22.3 |
583 |
58.2 |
41.9 |
|
Ficus benjamina |
30.2 |
19.4 |
28.1 |
22.3 |
583 |
58.3 |
41.7 |
|
Ficus benghalensis |
30.0 |
19.7 |
28.0 |
22.3 |
583 |
58 |
42 |
|
Ficus benjamina var Gold Prestigious I |
28.1 |
22.5 |
30.0 |
19.4 |
583 |
58.1 |
41.9 |
|
Ficus microcarpa hawii |
30.4 |
19.4 |
28.0 |
22.3 |
583 |
58.4 |
41.7 |
|
Ficus elastica Roxb.ex Hornem |
28.1 |
22.3 |
30.0 |
19.6 |
583 |
58.1 |
41.9 |
|
Ficus elastica |
28.1 |
22.5 |
30.0 |
19.4 |
583 |
58.1 |
41.9 |
|
Ficus lyrata |
30.4 |
19.6 |
28.1 |
22.0 |
583 |
58.5 |
41.6 |
|
Ficus platyphlla |
28.0 |
22.1 |
30.4 |
19.6 |
583 |
58.4 |
41.7 |
|
Ficus religosa |
30.5 |
19.2 |
28.0 |
22.3 |
583 |
58.5 |
41.5 |
|
Ficus retusa |
30.4 |
19.4 |
28.0 |
22.3 |
583 |
58.4 |
41.7 |
|
Ficus tinctoria |
30.4 |
19.6 |
28.0 |
22.1 |
583 |
58.4 |
41.7 |
|
Avg. |
29.5 |
20.5 |
28.8 |
21.2 |
582.9 |
58.3 |
41.75 |
Table (6): The evolutionary analyses of nucleotide frequencies among 11 species of Ficus genus for matK gene.
|
The names of species |
T(U) |
C |
A |
G |
Total
|
AT |
GC |
|
Ficus altissima |
31.2 |
15.6 |
37.5 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus aspera |
37.3 |
16.1 |
30.9 |
15.7 |
751 |
68.2 |
31.8 |
|
Ficus bengamina |
31.2 |
15.6 |
37.4 |
15.8 |
751 |
68.6 |
31.4 |
|
Ficus benghalensis |
31.2 |
15.6 |
37.5 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus benjamina var gold prestigious I |
31.2 |
15.6 |
37.5 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus microcarpa hawii |
31.2 |
15.6 |
37.5 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus elastic |
31.2 |
15.6 |
37.5 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus elastica Roxb. ex Hornem |
31.4 |
15.6 |
37.3 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus retusa |
31.3 |
15.6 |
37.5 |
15.6 |
751 |
68.8 |
31.2 |
|
Ficus sycomorus |
31.4 |
15.6 |
37.3 |
15.7 |
751 |
68.7 |
31.3 |
|
Ficus tinctoria |
31.2 |
15.8 |
37.2 |
15.8 |
751 |
68.4 |
31.6 |
|
Avg. |
31.8 |
15.7 |
36.8 |
15.7 |
751.0 |
68.6 |
31.37 |
Table (7): Maximum Composite Likelihood Estimate of the Pattern of Nucleotide Substitution (Transition /Transversion ) for rbcL
|
|
A |
T |
C |
G |
|
A |
- |
7.44 |
5.15 |
11.36 |
|
T |
7.27 |
- |
9.34 |
5.36 |
|
C |
7.27 |
13.49 |
- |
5.36 |
|
G |
15.39 |
7.44 |
5.15 |
- |
Each entry shows the probability of substitution (r) from one base (row) to another base (column) (Tamura et al., 2004). The overall transition/transversion bias is R = 0.956, where R = [A*G*k1 + T*C*k2]/[(A+G)*(T+C)].
Table (8): Maximum Composite Likelihood Estimate of the Pattern of Nucleotide Substitution for matK
|
|
A |
T |
C |
G |
|
A |
- |
6.75 |
3.32 |
9.52 |
|
T |
7.82 |
- |
8.49 |
3.34 |
|
C |
7.82 |
17.23 |
- |
3.34 |
|
G |
22.31 |
6.75 |
3.32 |
- |
Each entry shows the probability of substitution (r) from one base (row) to another base (column)
(Tamura et al., 2004). The overall transition/transversion bias is R = 1.172, where R = [A*G*k1 + T*C*k2]/[(A+G)*(T+C)].
Table (9). Result from Tajima's Neutrality Test (Tajima D, 1989).
|
Locus |
m |
S |
ps |
Θ |
π |
D |
|
rbcL |
14 |
312 |
0.536082 |
0.168572 |
0.254768 |
2.308605 |
|
matK |
11 |
411 |
0.547270 |
0.186847 |
0.101416 |
-2.216143 |
The analysis involved 14 and 11 nucleotide sequences for rbcL and matK genes respectively .There were a total of 582 and 751 positions respectively. in the final dataset. Evolutionary analyses were conducted in MEGA X (Kumar et al., 2018).
DISSCUSION:
Ficus trees belonged to the Moraceae family are well known in the field of classical medicine. It is rich source of flavonoids and phenolic acid which make them able to protect against disorders of oxidative stress like as F. exasperate (Akanni et al., 2014). Some species such as the F. benjamina and F. retusa are considered as an important ornamental plant. There are other species produce fruits for nutrition such as F. sycomorus and F. carica in addition, F. elastica is a source of natural rubber because its contain on milky latex (Augustus and Seiler, 2011).
In this study, leaves were collected from Ficus trees for the determination of the potentiality of rbcL and matK regions as a barcode for 15 species. Identification using rbcL and matK regions matched with morphological identification 86% and 72% to species level respectively .The amplification rate of rbcl was 93% for species; while the amplification rate of matK was 80%. The low rate of matK amplification in plant taxa could be due to the great size for product amplification that is susceptible to degradation (Fazekas et al., 2012). DNA barcode should be unique identifiers, short sequence and universality (Stoeckle, 2003).
The generated query rbcl sequences of 14 plants were matched with the reference sequences in GenBank database and obtained accession number for most species. Although there were shape and texture leaf surface difference between F. afzeli, and F. aspera they showed similarity result with F. hirta this results were in agreements with (Nio et al., 2018) Codiaeum variegatum (L.) Blume.
The average AT nucleotide composition for rbcL of 14 species of Ficus was found to be (58. 3%) higher than GC content (41.75%) Similarly, in matK, average AT contents (59.46%) were higher as compared to the GC contents (31.4%). Similar findings have been reported by (Ismail et al., 2020) in Acacia sp.
The nucleotide transition substitution for rbcL gene was lower than transversion (R = 0.956 bp) and observed nucleotide diversity was higher than expected (ᴫ= 0.254768) indicated moderate of evolution rate among species (Ahmed and Fadl, 2019). However, The matK gene showed a high rate of nucleotide substitutions (R = 1.172) that inhibited PCR amplification.
Tajima D test Neutrality for rbcL revealed positive value, determined balancing selection to increase of moderate frequency alleles. On contrast The Tajima D for matK was negative value this indicated that this gene under purify selection were removing variation between individuals (Biswas and Akey, 2006).
Finally these results strengthen that rbcL is suitable gene for identification at the species level, similar results were in accordance with (Maloukh et al., 2017) and contrary to (chen et al., 2010)
CONCLUSION
The two barcode regions of rbcL and matK have a similar low identification at the cultivar level. Plastid matK region has few of GC content and more nucleotide substitutions, which evolves faster than rbcL region between the tested plants. Based on the estimation of recoverability, goodness of sequence and level of species discrimination the rbcL was higher than the matK gene in amplification, sequencing and identification. The rbcL could resolved various species belonged to Ficus genus region so, the rbcL region consider as a favorable barcode locus for different plant species.