Evaluation Of The Efficiency Of Some Bio-Fertilizers And Different Silicon Sources For Controlling Bulb Rot Of Lilium Spp. In Egypt

INTRODUCTION

Lilium spp. is a perennial bulb that comes from the Liliaceae family of flowering plants. Lilies are in high demand in the flower market as cut flowers, gardens/parks, landscaping, pot plants, greenhouses, and highly scented (Bakhshaie et al., 2016 and Lakshman et al., 2017). It is one of the most important bulbous flowers grown for cut flowers in Egypt and worldwide. This crop has recently gained popularity in several Egyptian governorates because their shapes possess natural beauty, fragrance, and different exquisite colors of their flowers. It is the source of the major alluring to buying (Mohamed et al., 2017). Diseases pose a major threat to the productivity and quality of lily bulbs and flowers production wherever they are grown. Because Lilium spp. was proved to be sensitive to different diseases as their bulbs contain much moisture, and their scales are thick and succulent, making pathogens easier to penetrate causing bulb rot disease (Sirin, 2011 and Mohamed et al., 2017).

Serious below-ground diseases infecting lily bulbs were obtained by Fusarium oxysporum, F. moniliforme, F. solani, F. semitectum, F. roseum, Rhizoctonia solani, and Pythium spp., resulting in major losses of lily bulbs (Lakshman et al., 2017, Zhou et al., 2018 and Hua et al., 2019).

Even though chemicals are available to control fungal diseases in the field and on harvested bulbs. However, for safety and environmental concerns, there is now a movement to find alternatives that reduce chemical applications and fungicides to control pathogens where the use of silicon sources is an important disease control alternative to lily bulbs (Khalifa et al., 2013, Mohamed et al., 2017, and Tsegaye et al., 2018). Silicon plays a vital role in activating disease resistance by improving plant growth and physiological characteristics of the plant cell. Accumulation of silica beneath cuticles fortifies the cell wall against pathogen attack (Jayawardana et al., 2014 and Elsharkawy et al., 2015). The use of silicon and or silica as a control method for soilborne pathogens, such as F. oxysporum and Pythium spp., (Sakr, 2016 and Khalifa et al., 2017).

Meanwhile, Bio-fertilizers are biologically active products or microbial inoculants, which are formulations containing one or more living microorganisms, such as beneficial bacteria, that when applied to soil colonize the rhizosphere or interior of the host plant and promote growth by increasing the availability of primary nutrients to the host plant (Eid et al., 2021 and Fasusi et al., 2021). So, it is considered an important component of organic farming because they help to maintain long-term soil fertility and sustainability by fixing atmospheric di-nitrogen, mobilizing fixed macro and micronutrients, and converting insoluble phosphorus in the soil into plant-available forms. Hence, they have important and long-term environmental implications, negating the adverse effects of chemicals (Nosheen et al., 2021 and Pirttiläet al., 2021).

Therefore, the present investigation aims to investigate environmentally alternative safer methods by evaluating the efficacy of some bio-fertilizers and sources of silicon for controlling bulb rot infecting Lilium spp. in Egypt.

MATERIALS AND METHODS

Laboratory and greenhouse experiments were carried out in “Research Branch, Plant Pathology Research Institute, Ornamental, Medicinal, and Aromatic Plant Diseases Research Department, El-Sabihia Agricultural Research Station, Alexandria”, while a field experiment was conducted in El-Qanater El-Khairia, Qalyubia governorate” during an average of two seasons of 2019 and 2020.

Plant materials: Two cultivars of bulbs of Lilium are lightly scented ('L. corleone' pinkish-red blooms, and 'L. litouwen' white), were obtained from Egypt Holland International CO., Elmenofia, Ashrnon, Egypt. It was purchased of uniform size from Ostensibly healthy bulbs (bulb sizes 18/20, diameter 2.5- 3.2 cm, and fresh weight 34.73 gm).

Chemicals: Three biofertilizers and silicate (silicon sources), compared to the Topsin-M^® 70% fungicide, were tested, shown in Table 1, noting that 5 grams of each of the biofertilizer powdered treatments were soaked in one liter of tap water for 72 hours, then continued mixing for 10 minutes to ensure complete mixing before treating.

Table 1: Bio-fertilizers, silicates and fungicide, their commercial name, composition, concentrations tested and source

I. Isolation, identification and frequency of fungi associated with bulb rot of lilies

The diseased lily bulbs, showing symptoms of bulbs rot, were sampled, were collected from different greenhouses and fields (in Alexandria, Giza and Qalyubia) in Egypt. The sample was thoroughly washed several times under tap water, air dried, cut infected parts into small pieces, each piece containing between healthy and rotten tissue. surface sterilized by immersing for 2 minutes in (1% active chlorine) sodium hypochlorite, washed in several changes of sterile distilled water (Muhanna 2020). Next dried between two sterilized filter papers then aseptically transferred into PDA at the rate of 4 pieces/plate and incubated for 4-7 days in the dark at 27±1^oC (Abdel-Rahman et al., 2020). Microscopically, the growing fungal colonies were examined. The number of fungi was counted, and the frequency of each fungus was calculated according to Mohamed et al. (2017) formula as follows:

The growing fungi were purified using hyphal tips or the single spore method (Riker and Riker, 1936) and (Dhingra and Sinclair, 1995). The isolate fungi were first identified according to their morphological and cultural characteristics as described by Domsch et al. (1980), Nelson et al. (1983), Nirenberg and O'Donnell (1998), Klich (2002), and Leslie and Summerell (2006). Identifications were then confirmed in the Mycological Center, Assiut University [AUMC], Egypt.

II. Pathogenicity tests

Pathogenicity was conducted as described by Mohamed et al. (2017) and Gálvez and Palmero (2021) using six fungal taken randomly to represent the six isolated species, one isolate for each fungal species, and tested on two ostensibly healthy Lilium cultivars i.e., 'L. corleone' and 'L. litouwen'. Bulbs were washed with tap water, surface-sterilized by dipping in 1.5% NaOCl solution for 1 min. rinsed with sterile distilled water. A sterile cork borer (10 mm diameter) was used to make a cavity near the basal part of each bulb (5 mm in deep). Then the tissues plug was pulled out. The mycelial disc of the equivalent diameter obtained from the edge of actively growing pure cultures (PDA medium) 7 days old was inserted into the cavities and the bulb was plugged, placed back, and tightly sealed with plastic film aseptically. Control bulbs were inoculated with sterile PDA agar plugs. Each fungus was replicated three times in a total of 45 bulbs/ tested isolates. To maintain high humidity, the inoculated bulbs were placed separately in individual plastic trays, each of which has five rows, and each row has three bulbs with wet filter paper and is covered with cling film. Incubation was carried out at 27±1 ºC under laboratory conditions, constantly observed and checked weekly.

Disease severity was determined 4 weeks after bulb inoculation (Mohamed et al., 2017). Measurement of percentage of disease severity was conducted according to Gálvez and Palmero (2021) as the infested bulbs were rated visually according to the following scale with five categories. (1) no visual infection (bulbs are completely healthy); (2) a few it rotten covering as less than 10% of the bulb area; (3) moderately rotten covering up to 25% of the bulb area; (4) heavily rotten covering until it reaches 50% of the bulb area and (5) rotten covering up to 75% of the bulb area (dead by the completely decayed bulb).

Whereas: n = Number of infected bulbs, R= Category number, N = Total number of examined bulbs, and 5 = The highest category number of infections. The disease symptoms of artificially infected bulbs were also reisolated and compared with the original isolates at the end of the test of each fungus.

III. Molecular identification of Fusarium oxysporum fungal isolate

Molecular identification of the recovered F. oxysporum fungal isolate that showed the highest disease severity of bulb rot in the pathogenicity test. The isolate was grown in sterile petri plates containing autoclaved potato dextrose agar (PDA) medium and incubated for 7 days at 28°C (Pitt and Hocking, 2009). The cultures were sent to the Molecular Biology Research Unit, Assiut University for DNA extraction using a Patho-gene-spin DNA/RNA extraction kit provided by Intron Biotechnology Company, Korea. Samples of fungal DNA were sent to SolGent Company, Daejeon, South Korea for polymerase chain reaction (PCR) and 18S sequencing. PCR was performed using ITS1 (forward) and ITS4 (reverse) primers which were incorporated in the reaction mixture. Primers have the following composition: ITS1 (5' - TCC GTA GGT GAA CCT GCG G - 3'), and ITS4 (5'- TCC TCC GCT TAT TGA TAT GC -3'). The purified PCR products (amplicons) were sequenced with the same primers with the incorporation of ddNTPs in the reaction mixture (White et al., 1990). The obtained sequences were analyzed using the Basic Local Alignment Search Tool (BLAST) from the National Center of Biotechnology Information (NCBI) website. Phylogenetic analysis of sequences was done with the help of MegAlign (DNA Star) software version 5.05. 

IV. Greenhouse experiment

Evaluation of the efficacy of some bio-fertilizers and silicates compared to Topsin-M^® fungicide against F. oxysporum under greenhouse conditions

The above-mentioned bio-fertilizers and silicates were tested for their efficacy to control F. oxysporum f. sp. gladioli (as the isolated F. oxysporum in the survey was identified in the molecular analysis as F. oxysporum AUMC15124). This was conducted under greenhouse conditions using two ostensibly healthy Lilium cultivar i.e., 'L. corleone' and 'L. litouwen'. Inocula of the tested fungus were prepared by growing them at 27±1 ºC in pure cultures (PDA). After 7 days, one mycelial disc 5 mm in diameter was taken from the margins of colony growth in plates and transferred onto pure sterilized sorghum sand medium (75 and 25 g) from the sorghum and fine washed sand, and 50 ml tap water, respectively in 200 ml glass bottles (Muhanna 2020) for 20 days at 27±1 ºC (Mohamed et al., 2017). Plastic pots (30-cm-diameter) were sterilized with sodium hypochlorite (5%), then inverted, and left to dry for a day before being used for planting. The used soil was made up of a mix of peat moss, loam, and sand (at 1:1:1 g/g) Loam and sand were sterilized over a sequenced three-day period by Autoclaving at 121°C for 30 minutes. Each soil in a plastic pot (9 kg) was pre-infested with F. oxysporum tested isolate at a rate of 3% (w/w) one week before planting. Lilium bulbs were dipped in each treatment as shown in Table 1 for 20 min immediately before planting. Then treatments were applied again 4 weeks after sowing with irrigation water. Each treatment contained 45 replicate pots (1 bulb/pot).

The disease incidence (percentage of infection), DI %, was recorded 12 weeks after planting according to Raju and Naik (2007) using the following formula:

Also, the efficacy of the tested treatments (TE %) was calculated relative to the untreated control according to Farag et al. (2018) according to the following formula:

V. Field experiment

Evaluation of calcium silicate and Phosphorine^® in comparison to Topsin-M^® to control bulbs rot of lily under field conditions

Based on the results of the greenhouse experiment, calcium silicate and phosphorine^® in comparison to Topsin-M^® 70% fungicide was selected to be tested for their efficacy on the highly susceptible 'L. litouwen' cultivar of lilium. The field trial was conducted in a field known for having intensive infection with bulb rot of lily. The cultivar was planted highly susceptible to infection of diseases. The plot (sandy loam soil with good drainage) was divided into three sections (three replications) for each treatment, each of which has five rows, and each row has 12 bulbs, with a total of 60 bulbs of spacing between them (widths x lengths cm) (20 x 20), with a total area of (100 x 250) per replications. The sections were separated by a one-meter free space. Prior to planting, all necessary horticultural precautions were taken. Bulbs were planted at a depth of 6-8 cm, with the pointy part of it facing upwards. It was watered as needed throughout the entire trial.

Lilium bulbs were dipped in solutions each treatment of Phosphorine^® (5g/l), calcium silicate (5g/l), and Topsin-M^® 70% wp fungicide (3g/l) for 20 min immediately before planting. Then treatments were applied again 4 weeks after sowing with irrigation water.

Each separately was carried out in the early morning (Khalaj 2010). At the end of the test (twelve weeks after planting), plant growth parameters, i.e., the number of flowers per plant, plant height (cm), and bulbs weight (g) were determined. The percentage of disease incidence (DI %) was calculated according to Raju and Naik (2007). Also, the efficacy of the tested treatments (TE %) on bulbs and plants were calculated relative to the untreated control according to Farag et al. (2018), as above mentioned.

Statistical analysis

A randomized complete block design was used with three replications for each treatment. The collected data were statistically analyzed with the Statistix programmer. And means comparisons were performed at the 5% level using the least significant difference (LSD) according to Snedecor and Cochran (1989).

 RESULTS

 I.                     Frequency of fungi associated with Lilium spp. bulb rot

Data in Table 2. showed that six fungal species fungi have been isolated and identified from the collected samples. However, most of the mean frequency (%) isolated fungi from greenhouses and fields were Fusarium oxysporum isolates and constituted 44.77% of the total isolates recovered (370) from both greenhouse and field collected samples. This was followed by F. verticillioides (16.80%), F. proliferatum (15.46%), and then Pythium splendens, F. semitectum, and Rhizoctonia solani were isolated at lower frequencies less than 10.65% of the total isolates recovered.

* F. proliferatum (Matsoshima, Nirenberg= F. moniliforme in previous publication)

**F. verticillioides (Saccardo, Nirenberg = F. moniliforme in previous publications

   II.   Pathogenicity tests

Data of the pathogenicity test on 'L. corleone' and 'L. litouwen' cultivars, shown in Table 3., showed the ability of all fungi to cause bulb rot, but to different degrees. F. oxysporum showed the highest disease severity with mean over the two tested cvs. being 93.33%. This was followed by F. verticillioides, and F. proliferatum, with much lower disease severity values while Rhizoctonia solani showed the lowest value being 29.83% over the two tested cvs.

*At 0.05 of probability, values followed by a different letter (s) differ significantly and the values represent the average of 45 bulbs/ treatment

III. Molecular identification of Fusarium oxysporum recovered in the survey

F. oxysporum isolate was further identified by molecular methods as it represents the most dominant isolated fungus which caused the highest disease severity in the pathogenicity test. The good sequence quality was aligned to get the nearest relative with the highest similarity by the sample TF-5 F. oxysporum AUMC15124 (GB: MZ715094) (540 letters) i.e.,

[TAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGG

CGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTG

AGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAA TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCT

GGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTC

CCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCC

ACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA AGCGGAGGA]

The tested strain showed 100% identity and 100% coverage with several strains of F. oxysporum f. sp. gladioli accessed from the GenBank as seen in Figure 1.

 Fig. 1: Phylogenetic tree of the Fusarium oxysporum AUMC15124 isolate

 IV.   Efficacy of some bio-fertilizers and silicates compared to Topsin-M fungicide against the native isolate F. oxysporum f. sp. gladioli under greenhouse conditions

All the treatments shown in Table 1. were tested against the aggressive pathogenic isolate of F. oxysporum f. sp. Gladioli AUMC15124 and were evaluated under greenhouse conditions.

Table 4. showed that all the tested treatments significantly reduced the percentage of disease incidence (DI %) in bulbs, compared to the untreated control. Calcium silicate was the most effective and significantly decreased mean (DI %) to 12.5% over the two tested cvs. which was not significantly different from Topsin-M^® fungicide which showed 11.11%, his was followed by Phosphorine^® as showed 23.34%. The other treatments, however, showed a much lower effect compared to the untreated control 84.44%.

Table 4: Effect of the different treatments on the percentage of disease incidence (DI %) in bulbs after 12 weeks post-planting of two cultivars (L. corleone and L. litouwen) in potting soil infested with Fusarium oxysporum AUMC15124^** under greenhouse condition

** F. oxysporum = F. oxysporum f. sp. gladioli (according to the conducted molecular analysis), *At 0.05 of probability, values followed by a different letter (s) differ significantly and the values represent the average of 45 bulbs and or plants/treatment.

Meanwhile, it is evident in Fig. 2 that there were no significant differences between the efficiency of calcium silicate and Topsin-M^® on both tested cvs. against Fusarium oxysporum f. sp. gladioli when it was used to infect soil under greenhouse conditions. Topsin-M^® gave the highest treatment effectiveness (87.34 and 86.28%) followed by calcium silicate (85.96 and 84.52 %), while Phosphorine^® was of a lower effective (73.53 and 71.34%) than either calcium silicate or Topsin-M^®, while Biogen^® was the least effective (40.09, 45.65 %, respectively).

V.Evaluation of calcium silicate and Phosphorine^® in comparison to Topsin-M^® to control bulbs rot under field conditions 

This trial is conducted in a field naturally heavily infested with bulb rot of lily to investigate the efficacy of calcium, Phosphorous^® silicate, and Topsin-M^® on 'Lilium litouwen' under natural field infection conditions

Data in Table 5 revealed that the tested treatments significantly reduced the incidence of the bulb rot disease on Lilium litouwen cultivar under natural field infection conditions (Table 5 & Fig. 3).

As shown in Table 5, Topsin-M^® as a fungicide was effective and showed a significant decrease in the bulb rot. The percentage of disease incidence in bulbs reached 15.56, followed by calcium silicate with 18.89, then Phosphorine^® with 20.0, compared to 50.00 % for the untreated control.

Concerning plant growth parameters, (plant height [cm], number of flowers [No.], and bulbs weight [g]), it was noticed that these parameters were significantly increased with calcium silicate treatment and the average of these values was 427.67 cm, 40.00, and 848.33 g, followed by Phosphorine^® as bio-fertilizers (420.00 cm, 39.33, and 675.67 g). This was followed by the application of Topsin-M^® as fungicide 306.00 cm, 25.67, and 501.33g compared to the untreated plants with 193.33 cm, 19.33, and 268.33 g, respectively.

Table 5: Effect of calcium silicate, Phosphorine^® and Topsin-M^® on bulb rot disease incidence (%) and growth parameters of lily (cv. 'Lilium litouwen') under field conditions

Bulbs were dipped in each treatment for 20 min immediately before planting, then treatments were applied again 4 weeks after sowing with irrigation water. *Values followed by a different letter (s) differ significantly at 0.05 of probability, the values represent the average of 180 bulbs and or plants/treatment

Fig. 3 shows that the fungicide Topsin-M^® gave the highest significant percentage of efficiency in controlling bulb rot that infected Lilium litouwen, with an average efficiency percentage on both plants and bulbs (73.83 and 68.83), followed by calcium silicate (68.16 and 62.19) and Phosphorine^® (64.75 and 60.01%, respectively), compared with untreated control.